| Gene name |
SPAC1F8.01 |
| Gene ID |
45/E06 |
| Gene synonyms/obsolete |
ght3 |
| Gene product |
hexose transporter;
similar to Sp GHT1 and GHT2 and GHT4 and GHT5 and GHT6 and
SPCC548.06C and SPBC1348.14C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1668 |
| ORF length (spliced) |
|
| Entry clone length |
1668 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1F8.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATAGGTTTATTACATC |
| Rev primer name |
SPAC1F8.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGATATACGTAGGGTGTGAA |
| Amino acid length |
555 |
| Molecular weight |
62 |
| Isoelectric point (calc.) |
8.4 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
12 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLMVGVLFL |
| Localization (YFP) |
periphery |
| Comments for localization |
except cell tip and
site of septum formation |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |