Gene name |
SPCC576.17c |
Gene ID |
45/G08 |
Gene synonyms/obsolete |
|
Gene product |
transporter; unknown
specificity; similar to Sp car1 (paralog) |
Entry clone |
Cloned |
ORF length (unspliced) |
1753 |
ORF length (spliced) |
1578 |
Entry clone length |
1753 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC576.17.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGATACAAACGATGT |
Rev primer name |
SPCC576.17.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATGGGCAGCCGTGTTGATT |
Amino acid length |
525 |
Molecular weight |
59.3 |
Isoelectric point (calc.) |
6.9 |
Signal SEQ |
|
No. of transmembrane domain |
13 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGVALGPLFL/LVYIGSLII |
Localization (YFP) |
periphery; cytoplasmic
dots |
Comments for localization |
ambiguous
structure |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |