Gene name |
SPBC902.04 |
Gene ID |
46/B12 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical
coiled-coil protein; with RN rrm RNA recognition motif;
RNA-binding protein; predicted coiled-coil region;
non-essential; no apparent Sc ortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
1952 |
ORF length (spliced) |
1770 |
Entry clone length |
1952 |
No. of intron |
3 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC902.04.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCCGTTGTTCTTAGAAGA |
Rev primer name |
SPBC902.04.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGCGCCATCTTCCTTCTTCT |
Amino acid length |
589 |
Molecular weight |
66.8 |
Isoelectric point (calc.) |
6.6 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |