| Gene name |
SPCC74.01 |
| Gene ID |
46/F05 |
| Gene synonyms/obsolete |
sly1 |
| Gene product |
sec1 family; SNARE
binding activity; SNARE docking complex (TRAPP?); involved in
non-selective vesicle docking; syntaxin binding protein;
involved in intracellular protein transport; involved in
secretory pathway; involved in exocytosis; involved in
non-selective vesicle docking; involved in ER to golgi
transport; interacts physically with Sed5p |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2179 |
| ORF length (spliced) |
1920 |
| Entry clone length |
2179 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC74.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTATTGCATCTGTAAA |
| Rev primer name |
SPCC74.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGATAGAGAAGCCATTTCT |
| Amino acid length |
639 |
| Molecular weight |
71.6 |
| Isoelectric point (calc.) |
5.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LESDFFSLQL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
changed to:
nucleus>cytosol |
| Microscope used for
observation |
Leica |