| Gene name |
SPBC11C11.02 |
| Gene ID |
46/G01 |
| Gene synonyms/obsolete |
imp2 |
| Gene product |
involved in
contractile ring assembly; non-essential; involved in
cytokinesis; FCH domain; src (SH3) homology domain; similar to
Sp SPAC20G8.05C; involved in septation (required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2220 |
| ORF length (spliced) |
2013 |
| Entry clone length |
2220 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC11C11.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTCAACAATTAAGCTT |
| Rev primer name |
SPBC11C11.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAACCTCGATTTCACGAACA |
| Amino acid length |
670 |
| Molecular weight |
75.1 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol; cytoplasmic
dots, especially at cell tip |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |