| Gene name |
SPAC4G8.04 |
| Gene ID |
46/H01 |
| Gene synonyms/obsolete |
|
| Gene product |
TBC domain protein;
GTPase activating protein; Rab-like GTPase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2382 |
| ORF length (spliced) |
2319 |
| Entry clone length |
2382 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
2094T:deletion |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC4G8.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAACCATCTGTTTCTGA |
| Rev primer name |
SPAC4G8.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAATTGACCGCTAAGTTT |
| Amino acid length |
772 |
| Molecular weight |
86.2 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LHSIPGSLHL/LPEIYSHLEL |
| Localization (YFP) |
periphery with
discontinuity |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |