| Gene name |
SPBC24C6.09c |
| Gene ID |
46/H07 |
| Gene synonyms/obsolete |
|
| Gene product |
transketolase; similar
to Synechocystis sp. P74690; phosphotransacetylase; bacterial
enzyme splits fructose-6-P and/or xylulose-5-P with the aid of
inorganic phosphate into either acetyl-P and erythrose-4-P
and/or acetyl-P and glyeraldehyde-3-P; no apparent Sc
ortholog |
| Entry clone |
Cloned; Mixture |
| ORF length (unspliced) |
2478 |
| ORF length (spliced) |
|
| Entry clone length |
2478 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC24C6.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCTACTCAAAACGATAT |
| Rev primer name |
SPBC24C6.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAATGTGGAAGTCTTATTT |
| Amino acid length |
825 |
| Molecular weight |
92.5 |
| Isoelectric point (calc.) |
6.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytosol=nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Confocal |