| Gene name |
SPBC1539.05 |
| Gene ID |
46/H08 |
| Gene synonyms/obsolete |
|
| Gene product |
Golgi transport
complex subunit predicted; Sec34-like family; involved in
intracellular protein transport; involved in secretory
pathway; involved in retention of proteins in the Golgi
apparatus; involved in ER to Golgi transport; involved in
retrograde transport; similar to S. cerevisiae
YER157W |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2479 |
| ORF length (spliced) |
2208 |
| Entry clone length |
2479 |
| No. of intron |
6 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1539.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTTGATCAGTTGGAGTT |
| Rev primer name |
SPBC1539.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAACTCATAACGGAGTAAATA |
| Amino acid length |
735 |
| Molecular weight |
85.9 |
| Isoelectric point (calc.) |
4.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLFDLEKLRL/LFLIKNFLVL |
| Localization (YFP) |
cytoplasmic dots;
periphery at site of septum formation |
| Comments for localization |
a lot of fine
dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |