Gene name |
SPBC13E7.05 |
Gene ID |
46/H09 |
Gene synonyms/obsolete |
|
Gene product |
mannosyltransferase;
transfers the first mannose to glycophosphatidylinositol on
the luminal side of the ER |
Entry clone |
Cloned |
ORF length (unspliced) |
2498 |
ORF length (spliced) |
2448 |
Entry clone length |
2498 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC13E7.05.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTACATTCCTTGAAGT |
Rev primer name |
SPBC13E7.05.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAAAGAATCTAATATTATT |
Amino acid length |
815 |
Molecular weight |
94.6 |
Isoelectric point (calc.) |
9.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
15 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LRLRISYLAL/LLLGLLMRLVL/LLSINQLKI/LFAFLPQLSL/LWIIGQLLWL/LGKSVFIPLWL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |