Gene name |
SPBC354.08c |
Gene ID |
47/A04 |
Gene synonyms/obsolete |
|
Gene product |
conserved
hypothetical; hypothetical protein; DUF221; involved in
sporulation; non-essential |
Entry clone |
Cloned |
ORF length (unspliced) |
2634 |
ORF length (spliced) |
2598 |
Entry clone length |
2634 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC354.08.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTAATTGAGAAACGTGA |
Rev primer name |
SPBC354.08.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAAAAAATGTGGTAATATTTA |
Amino acid length |
865 |
Molecular weight |
99.2 |
Isoelectric point (calc.) |
8.1 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLSVILLCI/LANIILFLCL |
Localization (YFP) |
cytoplasmic dots at
cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |