Gene name |
SPAC16A10.03c |
Gene ID |
47/A12 |
Gene synonyms/obsolete |
pep5 |
Gene product |
involved in
intracellular protein transport; involved in vacuole fusion;
similar to Sp SPAC823.12 (paralog); zinc finger protein;
zf-C3HC4 type (RING finger); ubiquitin ligase (E3) |
Entry clone |
Cloned |
ORF length (unspliced) |
2677 |
ORF length (spliced) |
2583 |
Entry clone length |
2677 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC16A10.03.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATATAAACGAGGTAGA |
Rev primer name |
SPAC16A10.03.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAACATAACTGAATCAATA |
Amino acid length |
860 |
Molecular weight |
99 |
Isoelectric point (calc.) |
6.8 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNFCFLKPLLL |
Localization (YFP) |
cytosol=nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |