| Gene name |
SPAC1327.01c |
| Gene ID |
47/E07 |
| Gene synonyms/obsolete |
SPAC18G6.16c;
SPAC1783.09c |
| Gene product |
transcriptional
regulator; zinc finger protein; zf-fungal Zn(2)-Cys(6)
binuclear cluster domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2934 |
| ORF length (spliced) |
|
| Entry clone length |
2934 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1327.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGCAACAGCGTTCAGG |
| Rev primer name |
SPAC1327.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATCCGGCAAACGAAATATTC |
| Amino acid length |
977 |
| Molecular weight |
107.8 |
| Isoelectric point (calc.) |
6.9 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
64 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nuclear dots; nucleus;
cytoplasmic dots |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |