| Gene name |
SPAC105.01c |
| Gene ID |
47/E10 |
| Gene synonyms/obsolete |
|
| Gene product |
CPA2 potassium
ion/proton antiporter |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2945 |
| ORF length (spliced) |
2697 |
| Entry clone length |
2945 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
2306T:G |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC105.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTATATTTCAAATATC |
| Rev primer name |
SPAC105.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATAACCTTGAACCATCTTT |
| Amino acid length |
898 |
| Molecular weight |
99.9 |
| Isoelectric point (calc.) |
7.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
10 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNLVSNLGL/LARILSELHL/LLLALGWCLFL/LVELIVLNI/LAGLIPLVL |
| Localization (YFP) |
periphery |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |