| Gene name |
SPCC1494.05c |
| Gene ID |
47/E09 |
| Gene synonyms/obsolete |
ubp12 |
| Gene product |
ubiquitin C-terminal
hydrolase activity; involved in protein deubiquitination;
involved in proteolysis (regulation) (supression); similar to
Sp SPCC16A11.12c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2940 |
| ORF length (spliced) |
|
| Entry clone length |
2940 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1494.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTCTCTGTCGGAAAG |
| Rev primer name |
SPCC1494.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGCTTGTTTTTCGGCGATAA |
| Amino acid length |
979 |
| Molecular weight |
111.9 |
| Isoelectric point (calc.) |
4.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLEGVKYTLSL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
nuclear dots by over
expression? |
| Effect of LMB on protein
localization |
changed to:
nucleus>>cytosol |
| Microscope used for
observation |
Leica |