Gene name |
SPBC216.06c |
Gene ID |
47/F08 |
Gene synonyms/obsolete |
swi1 |
Gene product |
involved in
mating-type determination; involved in imprinting at the
mating type locus (sensu Fungi); interacts with topoisomerase;
TPR domains (inferred from context); involved in DNA
replication (inhibition) |
Entry clone |
Cloned |
ORF length (unspliced) |
2991 |
ORF length (spliced) |
2916 |
Entry clone length |
2991 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPBC216.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTAGATGAGGTGAT |
Rev primer name |
SPBC216.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATCCGATGAAGAATTCTCG |
Amino acid length |
971 |
Molecular weight |
112.6 |
Isoelectric point (calc.) |
5.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
883/885 |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLLFRNILQI/LDAITELTI/LKDVPALFI |
Localization (YFP) |
SPB?; nuclear dots;
nucleus |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica,
DeltaVision |