| Gene name |
SPBC1861.04c |
| Gene ID |
48/A12 |
| Gene synonyms/obsolete |
|
| Gene product |
similar to C-term of
yeast U4/U6 splicing factor; RNA-binding protein; involved in
mRNA splicing; rrm RNA recognition motif |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3227 |
| ORF length (spliced) |
3045 |
| Entry clone length |
3227 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC1861.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTCAAATACAAGATTT |
| Rev primer name |
SPBC1861.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTTAAAAACATTTTCCTA |
| Amino acid length |
1014 |
| Molecular weight |
118 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
965 |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYPLIPELWL |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |