| Gene name |
SPCC1322.06 |
| Gene ID |
48/B01 |
| Gene synonyms/obsolete |
|
| Gene product |
karyopherin;
importin-beta family; similar to human RAN binding protein 11;
structural constituent of nuclear pore |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3229 |
| ORF length (spliced) |
2952 |
| Entry clone length |
3229 |
| No. of intron |
4 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC1322.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAAGTAGATCCTGTAGT |
| Rev primer name |
SPCC1322.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATAGCATGGATTGAAACTGT |
| Amino acid length |
983 |
| Molecular weight |
112.9 |
| Isoelectric point (calc.) |
5.4 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLDLLITKLLI/LNSSLLSRLLL |
| Localization (YFP) |
nuclear envelope;
nucleus |
| Comments for localization |
except nucleolus |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |