| Gene name |
SPCC18.03 |
| Gene ID |
48/B02 |
| Gene synonyms/obsolete |
|
| Gene product |
shuttle craft like
transcriptional regulator; zinc finger protein; zf-NF-X1 zinc
fingers (8); zf-C3HC4 type (RING finger); ubiquitin ligase
(E3); R3H domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3234 |
| ORF length (spliced) |
|
| Entry clone length |
3234 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
2244T:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC18.03.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAAACATCTAAAAATCC |
| Rev primer name |
SPCC18.03.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACAATTCAGTAGCAAGTTCC |
| Amino acid length |
1077 |
| Molecular weight |
121 |
| Isoelectric point (calc.) |
8.3 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi?; cytosol |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica,
DeltaVision |