| Gene name |
SPBC776.08c |
| Gene ID |
48/B12 |
| Gene synonyms/obsolete |
|
| Gene product |
hypothetical protein
Nrap; interacts with condensed chromosomes during mitosis;
involved in ribosome biogenesis and assembly |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3345 |
| ORF length (spliced) |
3294 |
| Entry clone length |
3345 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC776.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAATGGTTTGAAAAGAGA |
| Rev primer name |
SPBC776.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGGCTTTGAGTTGTAACTGG |
| Amino acid length |
1097 |
| Molecular weight |
126 |
| Isoelectric point (calc.) |
7.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LPKLISFGLLL |
| Localization (YFP) |
nucleolus>nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |