Gene name |
SPACUNK4.07c |
Gene ID |
48/E05 |
Gene synonyms/obsolete |
cta4; sev4;
SPAPYUK71.01 |
Gene product |
P-type ATPase; P4
type; involved in regulation of calcium homeostasis; involved
in cytokinesis; involved in cellular morphogenesis; involved
in microtubule based movement |
Entry clone |
Cloned |
ORF length (unspliced) |
3636 |
ORF length (spliced) |
|
Entry clone length |
3636 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPACUNK4.07.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGGGAGTAAGGCTTTAAT |
Rev primer name |
SPACUNK4.07.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAATTACGAAGAACAATTTCC |
Amino acid length |
1211 |
Molecular weight |
136.2 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
8 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LVQMHKILAL/LNTAIYLLQL |
Localization (YFP) |
ER |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Leica |