| Gene name |
SPBP23A10.07 |
| Gene ID |
48/E06 |
| Gene synonyms/obsolete |
rpa2 |
| Gene product |
DNA-directed RNA
polymerase I (subunit) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3684 |
| ORF length (spliced) |
|
| Entry clone length |
3684 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1600C:A /
2192C:A |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBP23A10.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAACAACGCTATACTATT |
| Rev primer name |
SPBP23A10.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTTAACTTCAAGCATCATT |
| Amino acid length |
1227 |
| Molecular weight |
137.7 |
| Isoelectric point (calc.) |
8.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAKHVADVLRL |
| Localization (YFP) |
mitochondrion? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |