| Gene name |
SPAC688.08 |
| Gene ID |
48/F01 |
| Gene synonyms/obsolete |
|
| Gene product |
RNA polymerase II
holoenzyme component |
| Entry clone |
Cloned directly into
pDUAL-FFH1 |
| ORF length (unspliced) |
3827 |
| ORF length (spliced) |
3702 |
| Entry clone length |
3827 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC688.08.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGCAATCGAGATTCAGC |
| Rev primer name |
SPAC688.08.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGTTATTAAATCATAAACT |
| Amino acid length |
1233 |
| Molecular weight |
142.9 |
| Isoelectric point (calc.) |
6.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLFSLEERLDL/LTFLCHLIL/LATLESLTI/LNFISSTLYL |
| Localization (YFP) |
no expression clone
|
| Comments for localization |
wrong LR-clone |
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|