| Gene name |
SPAC955.01c |
| Gene ID |
48/G07 |
| Gene synonyms/obsolete |
SPAC821.13c |
| Gene product |
P-type ATPase; P4
type; aminophospholipid translocase |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4689 |
| ORF length (spliced) |
|
| Entry clone length |
4689 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1245T:deletion /
3832C:T |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC955.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGTCTAGTGGTATCGC |
| Rev primer name |
SPAC955.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCTCGGCTTTTTAAATAT |
| Amino acid length |
1562 |
| Molecular weight |
176.7 |
| Isoelectric point (calc.) |
6.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
7 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFVMVCALTI |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |