Gene name |
SPBC12C2.10c |
Gene ID |
48/G08 |
Gene synonyms/obsolete |
pst1;
SPBC21D10.01c |
Gene product |
involved in chromatin
silencing; involved in histone deacetylation; sin3 family
corepressor; similar to Sp pst2 (paralog) |
Entry clone |
#Not cloned yet |
ORF length (unspliced) |
4706 |
ORF length (spliced) |
4569 |
Entry clone length |
4706 |
No. of intron |
1 |
Sequence status |
#Not cloned yet |
Sequence results |
#Not cloned (3'del:
1st clone/but this clone has another frameshift) |
Comments |
|
Polymerase used for cloning |
|
Fwd primer name |
SPBC12C2.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAAAAGACTGGCAAGA |
Rev primer name |
SPBC12C2.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACAGATCATCCTTGGAAGGC |
Amino acid length |
1522 |
Molecular weight |
171.4 |
Isoelectric point (calc.) |
5.9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
not cloned |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
|