| Gene name |
SPAC1D4.14 |
| Gene ID |
48/G10 |
| Gene synonyms/obsolete |
SPAC22F3.14c |
| Gene product |
THO complex component;
involved in mRNA export; involved in transcription by RNA
polymerase II |
| Entry clone |
Cloned |
| ORF length (unspliced) |
4942 |
| ORF length (spliced) |
4887 |
| Entry clone length |
4942 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC1D4.14.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGACTTCGTTGCCAGAAAA |
| Rev primer name |
SPAC1D4.14.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTGAATTTTTCTTCTTTTC |
| Amino acid length |
1628 |
| Molecular weight |
188.8 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |