| Gene name |
SPAC27F1.01c |
| Gene ID |
48/H03 |
| Gene synonyms/obsolete |
SPAC25G10.09c |
| Gene product |
actin cortical patch
component; predicted coiled-coil region; EF hand motif;
calcium binding protein; involved in actin cytoskeletal
organization; involved in endocytosis; divergent
repeat-containing; involved in actin cortical patch assembly;
WH2 motif; similar to Sp SPBC800.10C and SPBC83.01; target of
Ark1/Prk1 family kinases (potential) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5385 |
| ORF length (spliced) |
|
| Entry clone length |
5385 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC27F1.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCATATCCAAATCAGAT |
| Rev primer name |
SPAC27F1.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAGACAAATTCCCATACCAA |
| Amino acid length |
1794 |
| Molecular weight |
193.2 |
| Isoelectric point (calc.) |
9.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cell tip and site of
septum formation; cytosol |
| Comments for localization |
a lot of peripheral
dots by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |