| Gene name |
SPAC30.01c |
| Gene ID |
48/H05 |
| Gene synonyms/obsolete |
sec702; sec7b |
| Gene product |
Sec7 domain;
pleckstrin homology domain; transport protein; with sec
guanine nucleotide exchange factor; involved in secretory
pathway; non-clathrin vesicle coat component (putative);
involved in intracellular protein transport; similar to S.
pombe SPAC4D7.01c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
5469 |
| ORF length (spliced) |
|
| Entry clone length |
5469 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC30.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGCAGGATGCCTCTGAACC |
| Rev primer name |
SPAC30.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCCTGTTGGGCATTCAGG |
| Amino acid length |
1822 |
| Molecular weight |
206.7 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LKVTLETCLIL/LTCLFDYLFL/LNIIQGYLDL/LQNCVGYLTL |
| Localization (YFP) |
cytoplasmic dots
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |