| Gene name |
SPBC30D10.10c |
| Gene ID |
48/H11 |
| Gene synonyms/obsolete |
tor1 |
| Gene product |
phosphatidylinositol
kinase related kinase; TOR signaling pathway; involved in
starvation response (required); involved in stress response;
similar to Sp SPBC216.07c |
| Entry clone |
Cloned |
| ORF length (unspliced) |
7008 |
| ORF length (spliced) |
|
| Entry clone length |
7008 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPBC30D10.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAGTATTTTAGTGATCT |
| Rev primer name |
SPBC30D10.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTACCAAAAACTACACCATCCT |
| Amino acid length |
2335 |
| Molecular weight |
266.1 |
| Isoelectric point (calc.) |
6.8 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LEKLLTLGI/LQDILRLLNL/LPRIKHLEL |
| Localization (YFP) |
cytosol; cytoplasmic
dots |
| Comments for localization |
cytoplasmic dots by
over expression? |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica;
DeltaVision |