| Gene name |
SPAPB1E7.09 |
| Gene ID |
49/D10 |
| Gene synonyms/obsolete |
|
| Gene product |
glycosyl transferase
family 39; dolichyl phosphate-mannose-protein
mannosyltransferase; involved in O-glycosylation; MIR
domains |
| Entry clone |
Cloned |
| ORF length (unspliced) |
2220 |
| ORF length (spliced) |
|
| Entry clone length |
2220 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
408T:C / 1778T:C /
1905T:C / 1991T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1E7.09.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCCTATGAACAGCTTCA |
| Rev primer name |
SPAPB1E7.09.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCATGAACATTCCAAGAG |
| Amino acid length |
739 |
| Molecular weight |
85 |
| Isoelectric point (calc.) |
7.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
8 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGYFLVPLLL |
| Localization (YFP) |
ER |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
Leica |