| Gene name |
SPAC20H4.10 |
| Gene ID |
49/F10 |
| Gene synonyms/obsolete |
ufd2; SPAC145.04 |
| Gene product |
ubiquitin-protein
ligase (E4); U-box domain; ubiquitin fusion degradation
protein-2 |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3161 |
| ORF length (spliced) |
3033 |
| Entry clone length |
3161 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
1889T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC20H4.10.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAGTGATTTGGAAAAGGT |
| Rev primer name |
SPAC20H4.10.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCACTATTTCGCGAATGT |
| Amino acid length |
1010 |
| Molecular weight |
115.2 |
| Isoelectric point (calc.) |
5.7 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LFIPVLESLSL/LSRLDQRLDL/LSIIFDVYLNL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |