| Gene name |
SPAPB1E7.05 |
| Gene ID |
49/F11 |
| Gene synonyms/obsolete |
|
| Gene product |
glycerophosphoryl
diester phosphodiesterase domain; ankyrin repeat protein; Sc
PHO85 is a Cyclin-dependent kinase (CDK) inhibitor and
positive regulator of phosphate pathway but SPAPB1E7.05
appears to be lacking the SPX domain |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3231 |
| ORF length (spliced) |
|
| Entry clone length |
3231 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1064T:C / 1606T:C /
1858G:A / 3036G:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB1E7.05.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTGGAAAACGATCTTCA |
| Rev primer name |
SPAPB1E7.05.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCAGATTCCAAACTTTCA |
| Amino acid length |
1076 |
| Molecular weight |
118.1 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LLAFIQLDI/LKPLAPLPL/LIKAVKQLGL |
| Localization (YFP) |
cytosol |
| Comments for localization |
bright dots by over
expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |