| Gene name |
SPBC776.13 |
| Gene ID |
49/G08 |
| Gene synonyms/obsolete |
cnd1 |
| Gene product |
condensin subunit;
essential; involved in chromosome condensation
(required) |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3638 |
| ORF length (spliced) |
3477 |
| Entry clone length |
3638 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
209G:A / 411A:G /
1254C:T / 1427T:C / 1753T:C / 2233A:G / 2923T:C /
3427A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC776.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGTTGGATCTTCTTTC |
| Rev primer name |
SPBC776.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTATTCATGATATCCATCGTCA |
| Amino acid length |
1158 |
| Molecular weight |
131.3 |
| Isoelectric point (calc.) |
4.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSSLIPNLCL/LTSLEQMLCI/LCQKLCMLLL |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Leica |