| Gene name |
SPAC1093.01 |
| Gene ID |
49/G11 |
| Gene synonyms/obsolete |
SPAC12B10.18 |
| Gene product |
PPR domains;
translational regulator activity |
| Entry clone |
Cloned |
| ORF length (unspliced) |
3786 |
| ORF length (spliced) |
|
| Entry clone length |
3786 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
946T:G / 948T:C /
3722A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC1093.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGTTTACACGAAAGCTTG |
| Rev primer name |
SPAC1093.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATTGATAGAACTATTAATT |
| Amino acid length |
1261 |
| Molecular weight |
141.9 |
| Isoelectric point (calc.) |
7.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
cytoplasmic dots;
mitochondrion? |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |