| Gene name |
SPAC23G3.02c |
| Gene ID |
50/A04 |
| Gene synonyms/obsolete |
|
| Gene product |
peptide synthetase;
phosphopantetheine attachment site (3); no apparent Sc
ortholog |
| Entry clone |
Cloned |
| ORF length (unspliced) |
15005 |
| ORF length (spliced) |
14775 |
| Entry clone length |
15005 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
6564A:addition /
6565C:A / 1069?G:C |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC23G3.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAGAATTCAAATGAAGA |
| Rev primer name |
SPAC23G3.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAGTTCAATTTCCTTAATA |
| Amino acid length |
4924 |
| Molecular weight |
559.8 |
| Isoelectric point (calc.) |
6.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGRIINGKLYI/LAPSVDSLAI/LFKTLLNNLPI/LKNNLKPLLL/LREIFHLRI/LLDIKKWLNL/LPTAISALKI/LFNTIPFPLFL/LNWLTSLDL/LKDFRENLLL/LQYISLLDL |
| Localization (YFP) |
cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |