Gene name |
SPAPB17E12.08 |
Gene ID |
50/B05 |
Gene synonyms/obsolete |
|
Gene product |
hypothetical protein;
sequence orphan |
Entry clone |
Cloned |
ORF length (unspliced) |
475 |
ORF length (spliced) |
396 |
Entry clone length |
475 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAPB17E12.08.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGTTTTTTACTTAAATGG |
Rev primer name |
SPAPB17E12.08.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTACGCAGACACTAAAAAAGAA |
Amino acid length |
131 |
Molecular weight |
14.8 |
Isoelectric point (calc.) |
6.7 |
Signal SEQ |
|
No. of transmembrane domain |
3 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |