Gene name |
SPAPB17E12.10c |
Gene ID |
50/C10 |
Gene synonyms/obsolete |
|
Gene product |
SAM-dependent
methyltransferase; involved in rRNA methylation |
Entry clone |
Cloned |
ORF length (unspliced) |
1122 |
ORF length (spliced) |
906 |
Entry clone length |
1122 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPAC227.01.Fd |
Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGCGTTGATAGAGGATTT |
Rev primer name |
SPAC227.01.Rv |
Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAATCTGGATGTATTGTCGGG |
Amino acid length |
301 |
Molecular weight |
34 |
Isoelectric point (calc.) |
9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
no apparent
signal |
Comments for localization |
|
Effect of LMB on protein
localization |
not determined |
Microscope used for
observation |
DeltaVision |