| Gene name |
SPAPB2B4.03 |
| Gene ID |
50/E05 |
| Gene synonyms/obsolete |
cig2; cyc17 |
| Gene product |
Cig2/Cyc17 B-type
cyclin; G2/mitotic-specific cyclin; G1/S promoting complex;
regulated by DSC1/MBF complex; expressed at G1-S phase;
involved in conjugation (regulation); involved in start
control point of mitotic cell cycle |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1236 |
| ORF length (spliced) |
|
| Entry clone length |
1236 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
1080A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAPB2B4.03.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGGCTCTCTATTCAATTTC |
| Rev primer name |
SPAPB2B4.03.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAGTGACCATCATTTGTTAAA |
| Amino acid length |
411 |
| Molecular weight |
47.4 |
| Isoelectric point (calc.) |
8.1 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LTGITALLI |
| Localization (YFP) |
SPB?; nuclear dots;
nucleus |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |