| Gene name |
SPBC691.01 |
| Gene ID |
50/E06 |
| Gene synonyms/obsolete |
pi035;
SPBC17A3.11 |
| Gene product |
hypothetical protein;
human reduced expression conserved protein; human reduced
expression in cancer protein homolog; zinc finger protein;
zf-DHHC type; palmitoyltransferase activity; involved in
palmitoylation |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1242 |
| ORF length (spliced) |
939 |
| Entry clone length |
1242 |
| No. of intron |
5 |
| Sequence status |
Finished |
| Sequence results |
409T:C / 502T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC691.01.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGTCTACAAATTTAGAAGA |
| Rev primer name |
SPBC691.01.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTAAGAATTCATTGATAAAGCT |
| Amino acid length |
312 |
| Molecular weight |
35.9 |
| Isoelectric point (calc.) |
9.5 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
4 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
Golgi; periphery;
vacuole membrane; cytoplasmic dots |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |