| Gene name |
SPAC12B10.09 |
| Gene ID |
50/E12 |
| Gene synonyms/obsolete |
|
| Gene product |
mitochondrial carrier;
involved in mitochondrial transport; unknown specificity
|
| Entry clone |
Cloned |
| ORF length (unspliced) |
1325 |
| ORF length (spliced) |
1038 |
| Entry clone length |
1325 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC12B10.09.Fd |
| Fwd primer SEQ |
GGGGACAAGTTTGTACAAAAAAGCAGGCTCTCATATGATTTTTAACTATGTTTT |
| Rev primer name |
SPAC12B10.09.Rv |
| Rev primer SEQ |
GGGGACCACTTTGTACAAGAAAGCTGGGTACAATCCTTCGGCTTTCATA |
| Amino acid length |
345 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
10.2 |
| Signal SEQ |
|
| No. of transmembrane domain |
5 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LYWDVFSKLII |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |