| Gene name |
SPBC119.01 |
| Gene ID |
50/H07 |
| Gene synonyms/obsolete |
rpn3;
SPBPJ4664.07 |
| Gene product |
19S proteasome
regulatory subunit; TPR repeat protein (inferred from
context); PCI domain |
| Entry clone |
#Not cloned yet |
| ORF length (unspliced) |
1584 |
| ORF length (spliced) |
1494 |
| Entry clone length |
1584 |
| No. of intron |
2 |
| Sequence status |
#Not cloned yet |
| Sequence results |
#Not cloned/serious
mutation |
| Comments |
|
| Polymerase used for cloning |
|
| Fwd primer name |
SPBC119.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATTGATGATCAGAGAGG |
| Rev primer name |
SPBC119.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAAAATTCGCCCAAATCAGG |
| Amino acid length |
497 |
| Molecular weight |
57.3 |
| Isoelectric point (calc.) |
5.5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
not cloned |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
|