| Gene name |
SPCC188.04c |
| Gene ID |
51/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
kinetochore protein
Spc25; similar to S. cerevisiae YER018C |
| Entry clone |
Cloned |
| ORF length (unspliced) |
829 |
| ORF length (spliced) |
717 |
| Entry clone length |
829 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPCC188.04.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTTGGCAAACTTTCC |
| Rev primer name |
SPCC188.04.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAAATCAATTGAGACAGATCC |
| Amino acid length |
238 |
| Molecular weight |
28.8 |
| Isoelectric point (calc.) |
6.6 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
SPB |
| Comments for localization |
nucleus>=cytosol
and cytoplasmic dots at cell tip by over expression |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |