Gene name |
SPCC70.06 |
Gene ID |
51/D09 |
Gene synonyms/obsolete |
|
Gene product |
SAC3/GANp family;
involved in nuclear export; similar to Sp SPCC576.05 |
Entry clone |
Cloned |
ORF length (unspliced) |
1456 |
ORF length (spliced) |
1377 |
Entry clone length |
1456 |
No. of intron |
2 |
Sequence status |
Finished |
Sequence results |
705G:T |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPCC70.06.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCGACTAAAGTTAAGCA |
Rev primer name |
SPCC70.06.Rv |
Rev primer SEQ |
AGAAAGCTGGGTACCTTTGGCGCACAATGCTT |
Amino acid length |
458 |
Molecular weight |
52.3 |
Isoelectric point (calc.) |
10 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleolus>nucleus=cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
Zeiss |