Gene name |
SPAC750.02c |
Gene ID |
51/D10 |
Gene synonyms/obsolete |
|
Gene product |
putative membrane
transporter; telomeric duplication; similar to Sp
SPBC1348.05 |
Entry clone |
Cloned |
ORF length (unspliced) |
1458 |
ORF length (spliced) |
|
Entry clone length |
1458 |
No. of intron |
0 |
Sequence status |
Finished |
Sequence results |
1287A:T |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC750.02.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGAAAGAAGAGTCAATTTT |
Rev primer name |
SPAC750.02.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTATTTTGAGGGGTCAAAT |
Amino acid length |
485 |
Molecular weight |
54 |
Isoelectric point (calc.) |
9.7 |
Signal SEQ |
|
No. of transmembrane domain |
10 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LGATLYTLGI/LMYISITLGL |
Localization (YFP) |
Golgi; periphery,
especially at cell tip and site of septum formation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |