Gene name |
SPAC11E3.10 |
Gene ID |
52/A07 |
Gene synonyms/obsolete |
|
Gene product |
conserved in bacteria
VanZ-like family protein; conserved in bacteria; no apparent
Scortholog |
Entry clone |
Cloned |
ORF length (unspliced) |
861 |
ORF length (spliced) |
489 |
Entry clone length |
861 |
No. of intron |
4 |
Sequence status |
Finished |
Sequence results |
100% match |
Comments |
|
Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
Fwd primer name |
SPAC11E3.10.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGATGCTCCCATCCTATTT |
Rev primer name |
SPAC11E3.10.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGGGAGTAGATTTGGAAACA |
Amino acid length |
162 |
Molecular weight |
18.4 |
Isoelectric point (calc.) |
6.5 |
Signal SEQ |
Predicted
(N-terminus) |
No. of transmembrane domain |
4 |
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LAIFIVLLII/LGCSLALLLNI |
Localization (YFP) |
Golgi with
accumulation |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |