Gene name |
SPBC3B9.18c |
Gene ID |
03/D07 |
Gene synonyms/obsolete |
vma7 |
Gene product |
putative vacuolar ATP
synthase subunit F; vacuolar ATP synthase (subunit F);
vacuolar proton pump component; V1 sector |
Entry clone |
Cloned |
ORF length (unspliced) |
421 |
ORF length (spliced) |
363 |
Entry clone length |
421 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
(-7)C:deletion / 78A:G
/ 282T:C |
Comments |
5' terminus is
frameshifted. |
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC3B9.18.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTTCACAATCATATCG |
Rev primer name |
SPBC3B9.18.Rv |
Rev primer SEQ |
AGAAAGCTGGGTATTCTCCAATGATCTTTCTA |
Amino acid length |
120 |
Molecular weight |
13.6 |
Isoelectric point (calc.) |
4.5 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
nucleus>cytosol |
Comments for localization |
|
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |