| Gene name |
SPBC409.13 |
| Gene ID |
09/E04 |
| Gene synonyms/obsolete |
|
| Gene product |
6,7-dimethyl-8-ribityllumazine synthase; DMRL
synthase family; involved in riboflavin biosynthesis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
767 |
| ORF length (spliced) |
480 |
| Entry clone length |
767 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC409.13.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTTCAGTGGTATTAAAGG |
| Rev primer name |
SPBC409.13.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATACAAAGCTTTCAATCCC |
| Amino acid length |
159 |
| Molecular weight |
17.1 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LDSGVPVILGL |
| Localization (YFP) |
nuclear dots;
nucleus>cytosol |
| Comments for localization |
1~2 dots/cell |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |