| Gene name |
SPAC22E12.06c |
| Gene ID |
14/F03 |
| Gene synonyms/obsolete |
gmh3 |
| Gene product |
alpha-1,2-galactosyltransferase Gmh3; GMA12/MNN10
family; belongs to the glycosyltransferase 34 family;
predicted N-terminal signal sequence; a-methyl-D-mannoside as
an acceptor; involved in the galactosylation of the N-linked
core oligosaccharide Man(9)GlcNAc(2); similar to S. pombe gmh1
and gmh2 and gma12 and SPBC1289.13C and SPAC5H10.13C and
SPAC637.06 and SPBC8D2.17 |
| Entry clone |
Cloned# |
| ORF length (unspliced) |
999 |
| ORF length (spliced) |
|
| Entry clone length |
999 |
| No. of intron |
0 |
| Sequence status |
Finished |
| Sequence results |
100% match |
| Comments |
|
| Polymerase used for cloning |
Pyrobest DNA Pol
(TaKaRa) |
| Fwd primer name |
SPAC22E12.06.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGCAGTCCTACAGTGGAA |
| Rev primer name |
SPAC22E12.06.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATGAACCCTCTCACGATAT |
| Amino acid length |
332 |
| Molecular weight |
38 |
| Isoelectric point (calc.) |
5.1 |
| Signal SEQ |
Predicted
(N-terminus) |
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LSRVIFVLLII |
| Localization (YFP) |
no apparent
signal |
| Comments for localization |
|
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
DeltaVision |