| Gene name |
SPCC1919.02 |
| Gene ID |
17/C02 |
| Gene synonyms/obsolete |
|
| Gene product |
protease B; involved
in post-translational processing of protease |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1098 |
| ORF length (spliced) |
999 |
| Entry clone length |
1098 |
| No. of intron |
2 |
| Sequence status |
Finished |
| Sequence results |
416T:G / 832C:T |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPCC1919.02.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGATTTACAAAGAACAAA |
| Rev primer name |
SPCC1919.02.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAATCCTTTGCGTAACGGAAC |
| Amino acid length |
332 |
| Molecular weight |
38.4 |
| Isoelectric point (calc.) |
5.9 |
| Signal SEQ |
|
| No. of transmembrane domain |
1 |
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LETVPNLDI |
| Localization (YFP) |
no apparent signal
|
| Comments for localization |
vacuole? |
| Effect of LMB on protein
localization |
not determined |
| Microscope used for
observation |
Confocal
|