| Gene name |
SPAC664.07c |
| Gene ID |
23/C09 |
| Gene synonyms/obsolete |
rad9 |
| Gene product |
involved in DNA
repair; involved in DNA damage checkpoint, DNA replication
checkpoint; 3' to 5' exonuclease |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1447 |
| ORF length (spliced) |
1281 |
| Entry clone length |
1447 |
| No. of intron |
3 |
| Sequence status |
Finished |
| Sequence results |
170A:G / 1175G:A /
1350A:G / 1393T:C |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPAC664.07.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGGAATTCACTGTTTCAAA |
| Rev primer name |
SPAC664.07.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTCTTCCTGAGAGAAAATG |
| Amino acid length |
426 |
| Molecular weight |
47.4 |
| Isoelectric point (calc.) |
5 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
LNEGVSVTLSL |
| Localization (YFP) |
nucleus>cytosol |
| Comments for localization |
|
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |