| Gene name |
SPBC23G7.01c |
| Gene ID |
23/E02 |
| Gene synonyms/obsolete |
SPBC18E5.11c |
| Gene product |
conserved hypothetical
protein; Sc YEL015W (homolog) is possibly involved in splicing
and other functions by 2-hybrid analysis |
| Entry clone |
Cloned |
| ORF length (unspliced) |
1456 |
| ORF length (spliced) |
1365 |
| Entry clone length |
1456 |
| No. of intron |
1 |
| Sequence status |
Finished |
| Sequence results |
888A:G |
| Comments |
|
| Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
| Fwd primer name |
SPBC23G7.01.Fd |
| Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTAGCTGATTTTTA |
| Rev primer name |
SPBC23G7.01.Rv |
| Rev primer SEQ |
AGAAAGCTGGGTAGTTAGTGCTGGTACATGAG |
| Amino acid length |
454 |
| Molecular weight |
49.2 |
| Isoelectric point (calc.) |
9 |
| Signal SEQ |
|
| No. of transmembrane domain |
|
| NLS position (Columbia Univ.
Bioinformatics Center) |
none |
| NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
| Localization (YFP) |
moving cytoplasmic
dots |
| Comments for localization |
moving dots |
| Effect of LMB on protein
localization |
no change |
| Microscope used for
observation |
DeltaVision |