Gene name |
SPBC23G7.01c |
Gene ID |
23/E02 |
Gene synonyms/obsolete |
SPBC18E5.11c |
Gene product |
conserved hypothetical
protein; Sc YEL015W (homolog) is possibly involved in splicing
and other functions by 2-hybrid analysis |
Entry clone |
Cloned |
ORF length (unspliced) |
1456 |
ORF length (spliced) |
1365 |
Entry clone length |
1456 |
No. of intron |
1 |
Sequence status |
Finished |
Sequence results |
888A:G |
Comments |
|
Polymerase used for cloning |
Platinum Taq HiFi
(Invitrogen) |
Fwd primer name |
SPBC23G7.01.Fd |
Fwd primer SEQ |
AAAAAGCAGGCTCTCATATGTCTGTAGCTGATTTTTA |
Rev primer name |
SPBC23G7.01.Rv |
Rev primer SEQ |
AGAAAGCTGGGTAGTTAGTGCTGGTACATGAG |
Amino acid length |
454 |
Molecular weight |
49.2 |
Isoelectric point (calc.) |
9 |
Signal SEQ |
|
No. of transmembrane domain |
|
NLS position (Columbia Univ.
Bioinformatics Center) |
none |
NES motif (
L-x(2,3)-[IVLMF]-x(2,3)-L-x-[LI]) |
none |
Localization (YFP) |
moving cytoplasmic
dots |
Comments for localization |
moving dots |
Effect of LMB on protein
localization |
no change |
Microscope used for
observation |
DeltaVision |